1. 8.1. Identifying DNA as the Genetic Material

2. Griffith finds a ‘transforming principle.’ Griffith experimented with the bacteria that cause pneumonia. He used two forms: the S form (deadly) and the R form (not deadly). Dead S made R deadly

3. Avery identified DNA as the transforming principle. Avery performed three tests on the transforming principle. –Showed DNA was present. –Matched chemical makeup to DNA –No DNA = no transformation

4. Hershey and Chase confirm that DNA is the genetic material. Hershey and Chase studied viruses that infect bacteria, or bacteriophages. – Used radioactive DNA and proteins –DNA found in bacteria, proteins not

5. 8.2. Structure of DNA DNA is composed of four types of nucleotides. DNA is made up of a long chain of nucleotides. Each nucleotide has three parts. –a phosphate group –a deoxyribose sugar –a nitrogen-containing base phosphate group deoxyribose (sugar) nitrogen-containing base

6. The nitrogen containing bases are the only difference in the four nucleotides.

7. Watson and Crick determined the three-dimensional structure of DNA by building models. Double helix Sugar-phosphate backbone Nitrogen base “rungs”

8. Watson and Crick’s discovery built on the work of Rosalind Franklin and Erwin Chargaff. –Franklin: even width –Chargaff’s rules stated that A=T and C=G.

9. T A C G Nucleotides always pair in the same way. The base-pairing rules show how nucleotides always pair up in DNA. Because a pyrimidine (single ring) pairs with a purine (double ring), the helix has a uniform width. – A pairs with T – C pairs with G

10. The backbone is connected by covalent bonds. hydrogen bond covalent bond The bases are connected by hydrogen bonds.

11. 8.3. DNA Replication Replication copies the genetic information. A single strand of DNA serves as a template for a new strand. Directed by base pairing Each body cell gets a complete set of identical DNA. What process allows this to happen? Review: During which phase does the DNA replicate?

12. Proteins carry out the process of replication. DNA serves only as a template. Enzymes and other proteins do all work 1.Enzymes unzip the double helix. 2.Free-floating nucleotides form hydrogen bonds with the template strand. nucleotide The DNA molecule unzips in both directions.

13. 4. Polymerase enzymes form covalent bonds between nucleotides in the new strand. 3. DNA polymerase enzymes bond the nucleotides DNA polymerase new strand nucleotide

14. DNA replication is semiconservative. original strand new strand Two molecules of DNA Two new molecules of DNA are formed, each with an original strand and a newly formed strand.

15. Concept Check: On a separate sheet of paper: List each scientist and draw a picture showing his/her/their contribution to DNA knowledge. Draw and label each part of a nucleotide Draw the picture at right, number and explain the steps for DNA replication on the picture. The first one is done for you as an example. What would be the next 4 bases on the left strand? 1. DNA unwinds

16. There are many origins of replication in eukaryotic chromosomes. DNA replication starts at many points in eukaryotic chromosomes. Why does replication need to happen at multiple points? Replication is fast and accurate. DNA polymerases can find and correct errors.

17. KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

18. Movie Review Put the structure used in the video next to each thing listed below. –Chefs –Castle –Recipe Book –Recipes –Ingredients

19. RNA carries DNA’s instructions. The central dogma states that information flows in one direction from DNA to RNA to proteins.

20. replication transcription translation The central dogma includes three processes. – Replication – Transcription – Translation RNA is a link between DNA and proteins.

21. RNA differs from DNA in three major ways. –RNA has a ribose sugar. –RNA has uracil instead of thymine. –RNA is a single-stranded structure.

22. start site nucleotides transcription complex Transcription is catalyzed by RNA polymerase. –RNA polymerase and other proteins form a transcription complex. –The transcription complex recognizes the start of a gene and unwinds a segment of it.

23. DNA RNA polymerase moves along the DNA Nucleotides pair with one strand of the DNA. –RNA polymerase bonds the nucleotides together. –The DNA helix winds again as the gene is transcribed.

24. RNA – The RNA strand detaches from the DNA once the gene is transcribed.

25. Concept Check Use a Venn Diagram to compare and contrast DNA replication and transcription Replication Transcription

26. The transcription process is similar to replication. Transcription and replication both involve complex enzymes and complementary base pairing. The two processes have different end results. –Replication copies all the DNA; transcription copies a gene. –Replication makes one copy; transcription can make many copies. growing RNA strands DNA one gene

27. Transcription makes three types of RNA. –Messenger RNA (mRNA) carries the message that will be translated to form a protein. –Ribosomal RNA (rRNA) forms part of ribosomes where proteins are made. –Transfer RNA (tRNA) brings amino acids from the cytoplasm to a ribosome.

28. KEY CONCEPT Translation converts an mRNA message into a polypeptide, or protein.

29. Translation converts mRNA messages into polypeptides. A codon is a sequence of three nucleotides that codes for an amino acid. codon for methionine (Met) codon for leucine (Leu) Amino acids are coded by mRNA base sequences.

30. The genetic code matches each RNA codon with its amino acid or function. The genetic code matches each codon to its amino acid or function. –three stop codons –one start codon, codes for methionine

31. A change in the order in which codons are read changes the resulting protein. Regardless of the organism, codons code for the same amino acid.

32. Amino acids are linked to become a protein. An anticodon is a set of three nucleotides that is complementary to an mRNA codon. An anticodon is carried by a tRNA.

33. Ribosomes consist of two subunits –The large subunit has three binding sites for tRNA. –The small subunit binds to mRNA.

34. For translation to begin, tRNA binds to a start codon and signals the ribosome to assemble. –A complementary tRNA molecule binds to the exposed codon, bringing its amino acid close to the first amino acid.

35. –The ribosome helps form a polypeptide bond between the amino acids. –The ribosome pulls the mRNA strand the length of one codon.

36. –The now empty tRNA molecule exits the ribosome. –A complementary tRNA molecule binds to the next exposed codon. –Once the stop codon is reached, the ribosome releases the protein and disassembles.

37. Recombinant DNA: DNA that contains genes from more than one organism Warm-Up Transcribe and Translate the following DNA sequence: TACAATGCGAGTGAGCGCTACACT –mRNA = AUGUUACGCUCACUCGCGAUGUGA –Amino acids= MET-LEU-ARG-SER-LEU-ALA-MET-STOP

38. TRANSCRIPTION/TRANSLATION ACTIVITY EXAMPLE DNA Strand #10: 1.Using base pairing rules, write the mRNA that would be complementary to this strand. 2.What would the tRNA anticodons be for the newly synthesized mRNA strand? CTA TTA CGA ACT TAG AGC ATT AAT TAT AAA CTT ATC GAU AAU GCU UGA AUC UCG UAA UUA AUA UUU GAA UAG CUA UUA CGA ACU UAG AGC AUU AAU UAU AAA CUU AUC D N A - I S - L I F E -

39. Transgenic organisms: contains one or more genes from another organism Warm-Up –Write the steps required to go from DNA to proteins (do not just write transcription and translation!)

40. Thursday, November 10 Gene sequencing: determining the order of nucleotides in genes or genome Warm-Up: –What are the 2 types of mutations? –Explain the difference between them. –How might mutations be a good thing?

41. Mutations Amino Acid Sequence (Mutation) MET-PHE-LEU-ILE-ARG-GLU-HIS-HIS-CYS-GLU-PRO-CAL-GLU- STOP (A new protein has been made that increases the thickness of your fur so you can dig longer for nuts into the winter and only have to stay at your home for 15 seconds instead of 1 minute) MET-LEU-STOP (No protein is made so no teeth) MET-PHE-SER-THR-ARG-GLU-HIS-HIS-CYS-LEU-SER-CAL- GLU-STOP (Protein not complete so skin in the fingers does not disappear and your fingers are all connected (webbed)) MET-PHE-THR-ARG-GLU-HIS-HIS-CYS-GLU-PRO-CAL-GLU- STOP (Missing vital components for leg protein and ankle bones fuse together) MET-LEU-LEU-ASN-SER-ARG-ALA-SER-LEU-STOP (No hands could form with this protein) MET-PHE-ASN-SER-ARG-ALA-SER-LEU-STOP (Protein incomplete and vision did not develop so you are blind)