1. Cell Controls How does a cell control its processes? http://i.livescience.com/images/080114-cell-control-02.jpg

2. DNA – deoxyribonucleic acid Unit of heredity Blueprint for proteins (instructions) Found in chromosomes in the nucleus of every cell http://imagecache2.allposters.com/images/pic/JAG/03-PS101-2~DNA-Posters.jpg

3. DNA Watson and Crick – proposed double helix shape of molecule (twisted ladder)

4. DNA Structure Monomer – nucleotide 1.Sugar (Deoxyribose) 2.Nitrogen Base 3.Phosphate biology.clc.uc.edu/graphics/bio104/nucleotide.jpg

5. DNA Structure Polymer – nucleic acid Backbone made of sugar and phosphate chain Steps of ladder are nitrogen bases http://publications.nigms.nih.gov/thenewgenetics/i mages/ch1_nucleotide.jpg

6. DNA Structure Four possible nitrogen bases in DNA Adenine Thymine Cytosine Guanine Base pair rules users.rcn.com/.../BiologyPages/B/BasePairing.gif

7. DNA Structure Video http://www.youtube.com/watch?v=qy8dk5iS1 f0&feature=player_embedded http://www.youtube.com/watch?v=qy8dk5iS1 f0&feature=player_embedded

8. DNA Model Lab Purpose: create a model of a DNA molecule 1.Separate gumdrops into color groups. 2.Designate a color for each component of the model, list in lab notebook. 3.Build a double helix model using toothpicks for bonds. 4.Use p. 284 in the text for a guide.

9. DNA Model Activity Questions Draw your model in your lab notebook. Answer: 1.In your model, are the sugar molecules directly across from each other? 2.Are the phosphates molecules directly across from each other? 3.What makes up the backbone? 4.How many adenine – thymine rungs did you make? 5.How many cytosine – guanine rungs did you make? 6.Is the arrangement of the bases of your ladder the same as others in the class? Why or why not?

10. DNA Replication Makes an exact copy of DNA molecule Occurs in nucleus before cell division Each cell will have its own set of instructions http://www.topnews.in/health/files/Identical-Twins.jpg

11. DNA Replication Steps 1.Original DNA strand unzipped by enzymes, base pairs separate http://images.google.com/imgres?imgurl=http://upload.wikimedia.org/wikipedia/commons/thumb/7/70 /DNA_replication_split.svg/297px- DNA_replication_split.svg.png&imgrefurl=http://commons.wikimedia.org/wiki/Image:DNA_replication_s plit.svg&usg=__8ipMfzUIe3bIB_V2tVy2tUoCmj0=&h=599&w=297&sz=74&hl=en&start=7&um=1&tbnid=g 8l_98FU03rvEM:&tbnh=135&tbnw=67&prev=/images%3Fq%3DDNA%2Breplication%26um%3D1%26hl%3 Den%26rls%3Dcom.microsoft:en-us%26sa%3DN

12. DNA Replication Steps 2. Free nucleotides base pair with open bases

13. DNA Replication Steps 3. Results in two identical copies of DNA molecule

14. DNA Replication Semi-conservative replication: each new strand has one backbone of the original strand http://library.thinkquest.org/C0123260/basic%20knowledge/images/basic%20knowledge/DN A/semiconservative%20replication.jpg

15. DNA Replication Practice Original DNA Strand New DNA Strands

16. DNA Replication Video Clips http://www.youtube.com/watch?v=4jtmOZaIv S0&feature=player_embedded http://www.youtube.com/watch?v=4jtmOZaIv S0&feature=player_embedded http://www.youtube.com/watch?v=hfZ8o9D1 tus&feature=player_embedded http://www.youtube.com/watch?v=hfZ8o9D1 tus&feature=player_embedded http://www.youtube.com/watch?v=rpwjZX_z5 rg&feature=player_embedded http://www.youtube.com/watch?v=rpwjZX_z5 rg&feature=player_embedded

17. RNA – ribonucleic acid Works to make proteins Ribose sugar in backbone Single stranded Base pairs: – Guanine, Cytosine – Adenine, Uracil – (No thymine in RNA) http://images2.clinicaltools.com/images/gene/rna2.jpg

18. Three types of RNA 1. Messenger RNA (mRNA) Found in nucleus and at ribosomes Forms codons – 3 base sequence Does transcription – copies DNA code in nucleus, moves to ribosome Cell Nucleus www.ncbi.nlm.nih.gov/.../images/mrna.gif

19. mRNA video

20. Three types of RNA 2. Ribosomal RNA (rRNA) Makes up ribosomes Reads mRNA codons and helps assemble amino acids in correct order

21. Three types of RNA 3. Transfer RNA (tRNA) Found in cytoplasm Transports amino acids to ribosomes and assembles them into a protein (translation)

22. Three types of RNA 3. Transfer RNA (tRNA) Brings amino acid to ribosome Anticodon pairs with mRNA codon at the ribosome Amino acid http://molbioandbiotech.files.wordpress.com/2007/09/trna1.gif Anti-codon

23. Types of RNA video

24. Compare DNA and RNA Deoxyribonucleic acid Holds the code for making proteins “The Boss” Found in the nucleus of cells Double helix – 2 strands Made of nucleotides Backbone Deoxyribose sugar Phosphate Nitrogen Bases Adenine Thymine Cytosine Guanine Ribonucleic Acid Copies the codes and helps make the proteins “The Workers” Found in nucleus and cytoplasm 3 types Messenger – mRNA Ribosomal – rRNA Transfer – tRNA Single strand Made of nucleotides Backbone Ribose sugar Phosphate Nitrogen Bases Adenine Uracil Cytosine Guanine

25. DNA Rap http://www.youtube.com/watch?v=d1UPf7lXe O8 http://www.youtube.com/watch?v=d1UPf7lXe O8

26. Biology Central Dogma DNA  RNA  Protein Transcription Translation

27. How are proteins made in a cell? Transcription: – Occurs in nucleus when a protein is needed – DNA  mRNA http://www.scientificpsychic.com/fitness/transcription.gif nucleus

28. Steps of transcription 1.DNA unzips 2.Free mRNA nucleotides join the open DNA bases 3.mRNA leaves DNA, DNA rezips 4.mRNA segment leaves nucleus, moves to ribosome

29. Steps of transcription Code is copied (transcribed) from DNA instructions DNA = T A C C G A T T G mRNA = A U G G C U A A C mRNA codon = 3 bases, codes for 1 amino acid

30. RNA Transcription Practice DNA strand: ATCCGGAATCCGTACGCTCTATAA RNA strand: ____________________________ What is this process called? Where does this process occur? Where will mRNA go after being made? What is the 3 base code on mRNA called? What does it code for?

31. Biology Central Dogma DNA  RNA  Protein Transcription Translation

32. mRNA code is translated into a protein Occurs at ribosome mRNA codon = amino acid How do we know what codon codes for which amino acid?

33. Amino Acid Chart

34. Steps of translation 1.mRNA attaches to ribosome 2.rRNA reads codons 3.tRNA brings in amino acid 4.tRNA anticodon matches mRNA codon 5.amino acids joined by peptide bonds to form a protein www.dorlingkindersley-uk.co.uk/static/clipart...

35. Easter Eggs and Proteins 1.Find ONE egg 2.Copy the DNA code from your egg 3.Transcribe it into mRNA codons 4.Determine the anticodon sequence for each message 5.Search out the correct anticodon card and copy the word on back in lab notebook 6.Write the sentence from the revealed words

36. Protein Synthesis Practice DNA: TACCGCTATCCCGAATAATAGAAT Copy this table and complete. Answer questions. DNAProcess  mRNAProcess  Amino Acid tRNA TAC

37. Protein Synthesis Practice Where is DNA in the cell? Where are amino acids assembled? Where is the codon found? What is it used for? Where is the anticodon found? What is it used for? Did you build a protein? Why?