1. DNA to Proteins Lab Science/Molecular Biology

2. Order of Operation To understand how DNA can make Proteins we must first learn how RNA is used to remove a DNA template from the nucleus

3. So, what do we know?... Write down what you know about DNA Write down what you know about RNA Share with your tablemates, combine your lists Share with the class

4. DNA is a nucleic acid, made of long chains of nucleotides DNA and RNA are polymers of nucleotides Figure 10.2A Nucleotide Phosphate group Nitrogenous base Sugar PolynucleotideSugar-phosphate backbone DNA nucleotide Phosphate group Nitrogenous base (A, G, C, or T) Thymine (T) Sugar (deoxyribose)

5. DNA has four kinds of bases, A, T, C, and G Thymine (T)Cytosine (C) Adenine (A)Guanine (G) DNA Sequences can be very long Human chromosomes contain hundreds of millions of nucleotides A tiny bacterium can contain a genome of several million nucleotides

6. James Watson and Francis Crick worked out the three-dimensional structure of DNA, based on work by Rosalind Franklin DNA is a double-stranded helix Figure 10.3A, B

7. Hydrogen bonds between bases hold the strands together: A and T, C and G Figure 10.3D Ribbon modelPartial chemical structureComputer model Hydrogen bond

8. RNA is also a nucleic acid  different sugar (Ribose)  Uracil (U) instead of Thymine (T)  Single strand, usually Figure 10.2C, D Phosphate group Nitrogenous base (A, G, C, or U) Uracil (U) Sugar (ribose)

9. RNA RNA is a close relative of DNA RNA has many functions  Provides coding for proteins  Helps synthesize proteins  Helps many basic processes in the cell RNA is NOT very stable  RNA is synthesized and very often degraded  DNA, by contrast, is very stable

10. Let’s Compare DNA and RNA DNARNA Double Helix (Double Strand) Single Strand Deoxyribose sugar Ribose Sugar Thymine Nitrogen Base Uracil Nitrogen Base Very Stable Not very stable

11. DNA and Genes DNA is made up of nitrogen bases DNA contains genes Genes: segments of DNA which code for specific proteins Genes are made of CODONS Codon: a sequence of three nitrogen bases which code for a part of a protein

12. Proteins Proteins determine the structure and function of an organism Proteins are made of chains of Amino Acids Codons code for Amino Acids

13. BIG PICTURE DNA  RNA  PROTEIN  TRAIT TRANSCRIPTION

14. Protein Synthesis Process Two steps to making proteins:  Transcription Changing from DNA code to mRNA code  Translation Reading RNA codes to make proteins

15. Types of RNA 3 Types of RNA  Messenger RNA (mRNA)  Transfer RNA (tRNA)  Ribosomal RNA (rRNA)

16. Transcription The process of making mRNA from DNA Takes place in the nucleus  DNA can not leave the nucleus (it’s like a secret recipe)  RNA is the code for the secret recipe that can leave the nucleus

17. Transcription Process: 1. Enzymes unzip DNA 2. Free RNA nucleotides pair with DNA nucleotides 3. RNA breaks away from DNA and DNA strands rejoin RNA strand made is called mRNA 4. mRNA leaves the nucleus and enters the cytoplasm looking for ribosomes

18. Transcription

19. Practice Write the following DNA strand on your paper: TACATACACGGGAAATTCCCCTAGATT 1. Make the opposite side of the DNA. 2. Make the mRNA strand

20. Practice Write the following DNA strand on your paper: TACATACACGGGAAATTCCCCTAGATT 1. Make the opposite side of the DNA. 2. Make the mRNA strand

21. BIG PICTURE DNA  mRNA  PROTEIN  TRAIT TRANSLATION

22. Translation The process of converting mRNA to a protein  Takes place on ribosomes  Uses tRNA which carries amino acids

23. Types of RNA 3 Types of RNA  Messenger RNA (mRNA)  Transfer RNA (tRNA)  Ribosomal RNA (rRNA)

24. tRNA tRNA transports amino acids Has an anticodon: a three base sequence that matches to a codon of mRNA tRNA acts like a delivery truck

25. Translation 1. mRNA codon attaches to the ribosome, at the “start” codon (AUG) 2. tRNA anticodon (UAC) pairs with mRNA codon 3. Ribosome slides mRNA to the next codon, correct tRNA anticodons pair up 4. Enzymes attach amino acids from the tRNAs to mRNA 5. Process continues forming a chain of amino acids until a “stop” codon (UAA, UAG, UGA) is reached

26. Translation

27. Practice Write the following DNA strand on your paper: (same example from earlier) TAC ATA CAC GGG AAA TTC CCC TAG ATT AUG UAU GUG CCC UUU AAG GGG AUC UAA UAC AUA CAC GGG AAA UUC CCC UAG AUU Start Tyr Val Pro Phe Lys Gly Ile Stop 1. Make the mRNA strand 2. Make the tRNA anticodons 3. List the Amino Acid chain formed (use mRNA)

28. Practice (mRNA to Amino Acids) AUGUAUGUGCCCUUUAAGGGGAUCUAA Find the Amino Acid: AUA CUA GGU ACG UAC AUG

30. Mutations Mutations are mistakes in the code for proteins Types  Chromosomal  DNA Base Pair

31. DNA Mutations Point Mutations: change in a single base pair on the DNA strand Example: TACAATCAT: met-leu-val TACTATCAT: met-ile-val

32. Mutations Frame Shift Mutations: adding or deleting a single base pair to the DNA strand Example: TACAATCAT: met-leu-val TACATCAT: met-stop

33. Mutation Practice Original DNA Strand: TACAAATTTCGCAGCGCTATC 1. Write the mRNA strand and amino acids formed 2. Write the mRNA strand and amino acids formed if the third A is deleted 3. Write the mRNA strand and amino acids formed if the second C is changed to A 4. How do the two amino acid chains change from the original?