1. DAY 2

2. Warm Up What type of RNA copies DNA? – mRNA What is this process called? – Transcription

3. Questions to be answered today How do we get from the base sequences found in DNA to a bunch of amino acids? How do we get from a bunch of amino acids to proteins?

4. Transcription RNA forms base pairs with DNA – C-G – A-U (NOT T) Primary transcript- length of RNA that results from the process of transcription

5. TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG

6. Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus Messenger RNA

7. Major players in transcription RNA polymerase 2 functions: – Unwind DNA sequence – strings together the chain of RNA nucleotides Does what both Helicase and DNA Polymerase did in DNA Replication

8. mRNA Processing Primary transcript is not mature mRNA DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before primary transcript is useful mRNA and can leave nucleus

9. Let’s Practice!

10. Closing Write a “journal response” using the Transcription vs. Translation Handout as a guide…ONLY FILL IN TRANSCRIPTION: – Purpose – Process – Location in cell – End product